a n Search Results


86
Jackson Laboratory n a mouse
N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm41747734-293-219-223?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
n a mouse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Merck & Co ggccttcgtttttgataagtc merck n a primer
Ggccttcgtttttgataagtc Merck N A Primer, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pmc12281364__mmc2-633-226-227?v=Merck+%26+Co
Average 86 stars, based on 1 article reviews
ggccttcgtttttgataagtc merck n a primer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Wikimedia Foundation a n
A N, supplied by Wikimedia Foundation, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/10__7146_slash_nys__v1i60__129348-91-1-21?v=Wikimedia+Foundation
Average 86 stars, based on 1 article reviews
a n - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f
Nnnnnnnnncggcatggacgagctg Sangon Biotech N A Linker Sadbc F, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm41338187-478-0-1?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
nnnnnnnnncggcatggacgagctg sangon biotech n a linker sadbc f - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Azenta genewiz n a id3 cdnaseq f
Genewiz N A Id3 Cdnaseq F, supplied by Azenta, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pmc12490220__mmc1-42-12-12?v=Azenta
Average 86 stars, based on 1 article reviews
genewiz n a id3 cdnaseq f - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Macklin Inc won jae lee n a escherichia coli atcc attc
Won Jae Lee N A Escherichia Coli Atcc Attc, supplied by Macklin Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm40811058-222-198-212?v=Macklin+Inc
Average 86 stars, based on 1 article reviews
won jae lee n a escherichia coli atcc attc - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech paper n a tn5 primera
Paper N A Tn5 Primera, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm40633538-330-26-31?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
paper n a tn5 primera - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech sangon biotech n a primer
Sangon Biotech N A Primer, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm41534530-729-51-52?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
sangon biotech n a primer - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Sangon Biotech sangon biotech n a p5 atac
Sangon Biotech N A P5 Atac, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm40633538-330-74-74?v=Sangon+Biotech
Average 86 stars, based on 1 article reviews
sangon biotech n a p5 atac - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Jackson Laboratory utrecht n a mouse
Utrecht N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm30917315-234-135-139?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
utrecht n a mouse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Jackson Laboratory n a
N A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm41422505-345-67-70?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
n a - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Jackson Laboratory paper n a mouse
Paper N A Mouse, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/a+n/pm41672043-305-99-108?v=Jackson+Laboratory
Average 86 stars, based on 1 article reviews
paper n a mouse - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

Image Search Results